بالعربي

التيلومير (Telomere)

التيلومير هو منطقة من تسلسل النوكليوتيدات المتكررة في نهاية كل كروموسوم، والذي يحمي نهاية الكروموسوم من التدهور أو من الالتحام مع الكروموسومات المجاورة. يشتق اسمها من الأسماء اليونانية (telo) أي الأخير و (mere) أي جزء . في الفقاريات، يكون تسلسل النيوكليوتيدات في التيلومير هو TTAGGG. هذه السلسلة من TTAGGG يتكرر ما يقرب من 2500 مرة في البشر. [1]

كروموسوم بشري (بالرمادي ) مغطى بالتيلومير ( الأبيض )

في أثناء النسخ المتماثل للكروموسوم، لا يمكن للأنزيمات التي تقوم على تكرار الحمض النووي أن تستمر بالنسخ الازدواجي على طول الطريق إلى نهاية الكروموسوم، لذلك يتم  تقصير نهاية الكروموسوم في كل عملية نسخ [2] (وهذا لان تركيب شظايا أوكازاكي يتطلب وجود قواعد RNA التي يجب أن تكون أمام الأجزاء الأخيرة ). تكون التيلوميرات بمثابة مخازن قابلة للتصرف في نهايات الكروموسومات التي يتم اقتطاع منها أثناء انقسام الخلية؛ وجودهم يحمي الجينات من قبلهم على كروموسوم من يتم اقتطاع بدلا من ذلك.

مع مرور الوقت، بسبب كل انقسام الخلايا، تصبح نهاية التيلومير اقصر [3]لكنها تتجدد من قبل إنزيم، ( التليوميريز الناسخ العكسي )

الاكتشاف

في بداية ال 1970s ، لاحظ المنظر الروسي اليكسي اولوفينكوف  أولا أن الكروموسومات لا يمكنها تكرار نهايتها تماما ، و بناء على هذا، واستيعابا لفكرة ليونارد هايفليك  من أن انقسام الخلايا الجسدية محدودة، اقترح اولوفينكوف  أن تسلسل الحمض النووي الذي يخسره الكرموسوم في كل مرة يعاد تكراره ، حتى تصل الخسارة إلى مستوى حرج، الذي ينتهي الانقسام الخلوي عنده . [4] [5 ] ومع ذلك، تنبؤ اولوفينكوف  لم يكن معروفا على نطاق واسع إلا من قبل حفنة من الباحثين الذين يدرسون الشيخوخة الخلوية وبقاءها . [6]

 

في 1975-1977، قامت إليزابيث بلاكبيرن، وبالعمل مع زميلها ما بعد الدكتوراه في جامعة ييل (جوزيف غال)، من اكتشاف طبيعة غير عادية للتيلومير، وهي أن التيلوميرات تحتوي على تسلسل بسيط متكرر للحمض النووي الذي يؤلف نهايات الكروموسومات. [7]. وفي عام ٢٠٠٩ منح كل من بلاكبيرن كارول جريدر، وجاك زوستاك جائزة نوبل في علم وظائف الأعضاء و الطب لاكتشافهم كيفية حماية الكروموسومات عن طريق التيلوميرات وإنزيم تيلوميراز. [8]

 

ومع ذلك، في 1970s كان هناك اعتراف بأن آلية تقصير التيلومير عادة يحد الخلايا لعدد محدد من الانقسامات، وبدراسة أجريت على الحيوانات أشارت إلى أن هذا يمكن أن يكون مسئولا عن الشيخوخة على مستوى الخلية ويضع حدا للأعمار. [9 ] [10]

 

وعملت غيرون  بتمويل خاص من شركة التكنولوجيا الحيوية  من عزل الجينات لمكون RNA والبروتين من التيلوميراز البشري من أجل تحديد دور تقصير التيلومير في شيخوخة الخلايا وتنشيط التيلوميراز في زيادة عمر الخلية. [11]

 

الطبيعة و الوظيفة:

التيلوميرات هي تسلسل النوكليوتيدات المتكررة التي تقع في نهاية الكروموسومات الخطية لمعظم الكائنات الحية حقيقية النواة. في الفقاريات، يكون تسلسل النيوكليوتيدات في التيلومير هو TTAGGG.لا يوجد التيلومير في معظم الكائنات بدائية النوى، التي تفتقر إلى هذا الترتيب الخطي . تعوض التيلومير عن تكرار الحمض النووي غير مكتمل شبه المحافظ على طرفي الكروموسومات. هناك بروتين مركب يعرف باسم shelterin يعمل بمثابة حماية ضد مزدوج الجديلة (DSB) بإصلاح من إعادة التركيب مثلي (HR) ونهاية غير المتجانسة الانضمام (NHEJ). [12] [13]

نموذج ثلاثي الأبعاد للتركيب الجزيئي للتيلومير

 

 

في معظم بدائيات النوى،تكون الكروموسومات دائرية، وبالتالي، لا يوجد لدينا نهايات تعاني إنهاء النسخ المبكرة. لكن هناك جزء صغير من الكروموسومات البكتيرية (مثل تلك الموجودة في السبحية، الأجرعية، وبوريليا) هي خطية وتمتلك التيلوميرات،و التي تختلف كثيرا عن تلك التي الصبغيات حقيقية النواة في هيكلها ووظائفها. الهياكل المعروف التيلومير البكتيرية تأخذ شكل البروتينات منضمة إلى نهايات الكروموسومات الخطية، أو حلقات دائرية الحمض النووي المفرد الموجودة في نهايات الكروموسومات الخطية. [14]

 

بينما يتم نسخ الحمض النووي، تقوم الإنزيمات بنسخ الحمض النووي للكائنات حقيقية النواة (الحمض النووي بوليميريز)لا يمكن نسخ التسلسلات في نهايات الكروموسومات (أو بتعبير أدق ألياف الكروماتيدات). وبالتالي، هذه المتتاليات والمعلومات التي تحملها قد تضيع. هذا هو السبب  في أن التيلوميرات هي في غاية الأهمية في سياق انقسام الخلايا الناجح: إنهم “تغلف”  نهاية المتواليات التي هي نفسها تضيع في عملية تكرار الحمض النووي. ولكن  الخلية لديها أنزيم يدعى التيلوميراز، الذي ينفذ مهمة بإضافة تسلسل النوكليوتيدات المتكررة لنهايات الحمض النووي.  وبالتالي، “يغذي” التيلوميراز التيلومير “المغلف ” من الحمض النووي. في معظم الكائنات الحية حقيقية النواة متعددة الخلايا، التيلوميراز  يكون نشطا فقط في الخلايا الجرثومية، وبعض أنواع من الخلايا الجذعية مثل الخلايا الجذعية الجنينية، وبعض خلايا الدم البيضاء. يمكن إعادة تنشيط التيلوميراز والتيلومير إعادة تعيين العودة إلى حالة جنينية عن طريق نقل نواة الخلية الجسدية. [15] وهناك نظريات التي تدعي أن تقصير ثابت التيلومير في كل مرة يكرر في جسدي (الجسم) الخلايا قد يكون له دور في الشيخوخة وفي الوقاية من السرطان. وذلك لأن التيلومير بمثابة نوع من التأخير الزمني ، يشغل  في نهاية المطاف بعد عدد معين من الانقسامات الخلوية ومما يؤدي إلى خسارة من المعلومات الوراثية الحيوية من كروموسوم الخلية مع الشعب المقبلة في نهاية المطاف .

عند نسخ ال DNA  , لا يستطيع إنزيم نسخ ال DNA  أن يقوم بنسخ التسلسلات الموجودة في نهاية الكروموسومات ( أو بتعبير أدق نهاية ألياف الكروماتيد ), وبالتالي، هذه المتتاليات والمعلومات التي تحملها قد تضيع. ولهذا فان التيلوميرات في غاية الأهمية في سياق انقسام الخلايا الناجح: تقوم (بإحاطة ) نهاية التسلسلات وبالتالي هي نفسها (التيلوميرات ) تضيع في عملية نسخ الكروموسومات . ولكن  كل خلية لديها أنزيم يدعى التيلوميراز، الذي ينفذ مهمة تزيد تسلسل النوكليوتيدات المتكررة لنهايات الحمض النووي.  وبالتالي، “تغذي” مغلف التيلومير أي نهاية التسلسلات ” من الحمض النووي.

في معظم الكائنات الحية حقيقية النواة متعددة الخلايا، التيلوميراز ينشط  فقط في الخلايا الأولية ، وبعض أنواع من الخلايا الجذعية مثل الخلايا الجذعية الجنينية، وبعض خلايا الدم البيضاء. يمكن إعادة تنشيط التيلوميراز والتيلومير بالعودة إلى حالة جنينية عن طريق نقل نواة الخلية الجسدية. [15] , وهناك نظريات تدعي أن تقصير التيلومير في كل مرة من انقسام الخلايا الجسدية قد يكون له دور في الشيخوخة وفي الوقاية من السرطان. وذلك لأن التيلومير بمثابة نوع من التأخير الزمني “لدمج”، وبالتالي تستهلك في كل عملية انقسام خلوي مستقبلية .

طول التيلومير يختلف كثيرا بين الأنواع، من حوالي 300 زوج قاعدي في الخميرة [16] لكثير من آلاف القواعد الامينية في البشر، وعادة ما تتألف من تسلسلات غنية بالحمض الاميني (جوانين) ، طوله بين الست إلى الثماني أزواج . التيلومير في الكائنات حقيقية النواة عادة ما  ينتهي بسلسلة احادية للحمض النووي المنتهية ب 3 ، وهو أمر ضروري لصيانة التيلومير وإحاطته. وقد تم تحديد  العديد من البروتينات التي تربط سلسلة الحمض الاميني المفرد والمزدوج في التيلومير. [17] ولها وظيفة في كل من الحفاظ على التيلومير و إحاطته .

تشكل التيلوميرات هياكل حلقة كبيرة تسمى حلقات شريط الحامض النووي، أو حلقات T.

هنا، يلتف الحمض النووي المفرد حولها في دائرة طويلة يثبت عن طريق البروتين الرابط للتيلومير . [18]

وفي نهاية حلقة T، يعقد الحمض النووي التيلومير الأحادي مع منطقة من الحمض النووي المزدوج من قبل حبلا التيلومير فتعطل قاعدة الاقتران المزدوج  للحمض النووي الحلزونية الشكل إلى واحد من فرعين اثنين. وهذا ما يسمى الهيكل الثلاثي حلقة الفصل أو حلقة D. [19]

تقصير التيلومير في البشر يمكن أن يحدث  بتقليل نسخ الحمض النووي،  الذي يمنع انقسام الخلايا. ويبدو أن هذه الآلية لمنع عدم الاستقرار الجيني وتطور السرطان في الخلايا عن طريق الحد من عدد من الانقسامات الخلوية. ومع ذلك،  فان عملية تقصير التيلوميرات تعوق الوظيفة المناعية التي قد تزيد أيضا قابلية السرطان. [20] وإذا أصبحت التيلوميرات قصيرة جدا،  فان لديهم القدرة على أن تتكشف من بنيتها المغلقة المفترضة. الخلية قد تكشف عن عدم الالتفاف الحاصل من التيلومير الذي ينتج تلف الحمض النووي ومن ثم إما تتوقف عن النمو، وتدخل الشيخوخة الخلوية (الشيخوخة)، أو تبدأ عملية تدمير الخلية المبرمح (موت الخلايا المبرمج) اعتمادا على الخلفية الوراثية للخلية (الوضع البروتين p53) . يؤدي التيلومير غير الملتف أيضا في اندماج الكروموسومات. وحيث أن هذا التلف لا يمكن إصلاحه في الخلايا الجسدية الطبيعية، الخلية قد تذهب حتى إلى موت الخلايا المبرمج. ترتبط العديد من الأمراض المتصلة بالشيخوخة إلى قصر التيلوميرات. تفنى أجهزة الجسم بالمزيد والمزيد من موت خلاياها أو إدخالها الشيخوخة الخلوية.

في النهاية البعيدة من التيلومير هناك 300 نقطة أساس لسلسة التيلوميرالذي يشكل حلقة T. هذه الحلقة مشابهة لعقدة، والتي تثبت التيلومير، وتمنع  اليات إصلاح الحمض النووي من التعرف على نهاية التيلومير.  لأنه إذا انضمت نهايات غير متجانسة على نهاية التيلومير فان ذلك سيؤدي إلى اندماج الكروموسومات  . ترتبط حلقات T معا من قبل العديد من البروتينات، من أبرزها TRF1، TRF2، POT1، TIN1، وTIN2، يشار إليها مجتمعة ب مجمع الشيلتيرين shelterin. في البشر، يتكون مجمع ال shelterin من ستة بروتينات التي يتم تحديدها عن طريق TRF1، TRF2، TIN2، POT1، TPP1، وRAP1. [12]

 

السرطان، التيلوميراز وALT (البديل إطالة التيلومير)

الخلايا الخبيثة التي تتجاوز الحد المعقول من النمو  تعيش أكثر بسبب تمديد التيلوميرالذي يرجع في معظمه إلى تفعيل التيلوميراز (إنزيم النسخ العكسي المسؤول عن تركيب التيلومير). التيلوميراز هو “مجمع بروتين نووي ريبوزي” يتكون من عنصر البروتين والحمض النووي الريبي التمهيدي و التسلسل الذي يعمل على حماية نهايات الطرفية للكروموسومات من أن يجري تحطيمها حسب الإنزيمات. التيلوميرات (وتصرفات التيلوميراز) ضرورية لأنه، أثناء النسخ المتماثل، لاتكون عملية البلمرة للDNA إلا باتجاه في 5 ‘إلى 3’ (في كل جزء من الحمض النووي يوجد قطبية التي يتم تحديدها من قبل بطريقة دقيقة لجزيئات السكر من سلسلتا ال DNA في “الهيكل الخاص” ليرتبطا معا)، و لا يمكن القيام بذلك إلا عن طريق إضافة النيوكليوتيدات إلى سلسلة RNA (التي تم وضعها في نقاط مختلفة على طول الحمض النووي). يتم استبدال خيوط RNA مع الحمض النووي لتوليفها حديثا، ولكن بلمرة DNA  هي عبارة عن  “إعادة ملئ” ريبوزية إذا كان هناك بالفعل الحمض النووي “المنبع” من (أي بعد 5 ” التمهيدي للRNA. ومع ذلك  ,في محطة الكروموسوم، ، ليس هناك تسلسل النوكليوتيدات في 5 اتجاه (وبالتالي لا يوجدRNA التمهيدي أو الحمض النووي المنبع)، لذلك فان بوليميريز الحمض النووي لا يمكن أن يعمل وقد يتم فقدان التسلسل الجيني من خلال تلف الكروموسومات. ويمكن أيضا معالجة نهايات الكروموسومات كما فواصل في الحمض النووي مزدوج الجديلة مع اندماج التيلومير للكروموسوم إلى الكروموسوم الناتج

 

 

يعمل التيلوميرالذي يقع في نهاية الحمض النووي من منع الكروموسوم من النمو بشكل أقصر خلال نسخه (الذي كان سيؤدي ال  فقدان المعلومات الوراثية) عن طريق استخدام  إنزيم التليوميريز”telomerases” الذي يجمع  الحمض النووي للكروموسوم. وتشمل هذه  العملية مجموعة فرعية من البروتينات و  الإنزيمات( إنزيم النسخ العكسي المتخصصة) المعروفة باسم TERT ( عكس ترجمة التيلوميراز) وتشارك في تركيب التيلومير في البشر وغيرها الكثير، ولكن ليس كل شيء في الكائنات الحية. ولأن آليات تكرار الحمض النووي تتأثر بالأكسدة , ايضا ,وجود ال TERT تكون منخفضة جدا في معظم أنواع الخلايا البشرية, فان التيلومير يتقلص قليلا في كل مرة تنقسم فيها الخلية.لكن , من بين أنواع الخلايا التي تتميز انقسام الخلايا بشكل واسع النطاق (مثل الخلايا الجذعية وبعض خلايا الدم البيضاء)، يكون إظهار الTERT  فيها على مستويات أعلى وبالتالي يتم منع التيلومير من أن يقصر جزئيا أو كليا.

بالإضافة إلى عنصر البروتين TERT للتيلومير، يحتوي التيلوميريز أيضا على قطعة من الحمض النووي الريبي قالب المعروفة باسم TERC (عنصر RNA للتيلوميريز) أو TR. في البشر، يكون تسلسل  التيلومير TERC عبارة عن سلسلة متكررة من TTAGGG، بين 3 و 20 الف قاعدة أمينية في الطول. هناك ما يقدر 100-300 20 الف قاعدة أمينية إضافية التي تكرر التيلومير المرتبطة بين التيلومير وبقية الكروموسوم. تختلف تسلسل التيلومير من نوع إلى نوع، ولكن، وبشكل عام، سلسلة  واحدة غنية ب G مع عدد أقل من السيزيوم. ويمكن لهذه متواليات-G الغنية تشكيل تسلسلات رباعية الابعاد  للهياكل (G-quadruplexes)، مع مجموعات من أربع قواعد التي عقدت مع بعضها ومن ثم تكدس فوق بعضها البعض، إما مع الصوديوم أو أيون البوتاسيوم على المستوى الهيكلي .

نموذج يحاكي تسلسلات رباعية الابعاد  للهياكل التي يمكن ان تصنع من التيلوميرات البشرية ( المصدر NDB UD0017.)

في الثدييات (وغيرها) من الخلايا الجسدية المفتقدة للتيلوميراز يفقد تدريجيا تسلسل التيلومير نتيجة النسخ غير مكتمل (العداد وآخرون، 1992). كما يؤدي تقصير التيلومير في الثدييات في نهاية المطاف إلى أن يصل هناك حد في نسخ الخلايا الذي يؤدي إلى شيخوختها . تقوم مسارات p53 و ال PRB إلى توقيف نمو الخلايا وبالتالي تقليل نسخها (Campisi، 2005). الشيخوخة قد تلعب دورا هاما في منع ظهور السرطان، على الرغم من أن وراثة تيلوميرات أقصر ربما لا تحمي ضد السرطان. [20] ومع تقصير التيلوميرات ، زيادة تكاثر الخلايا يمكن أن يتحقق عن طريق تثبيط البروتين p53 ومسارات PRB. الخلايا التي تدخل النسخ بعد تثبيط البروتين p53 ومسارات PRB تخضع لازمة , التي تتميز من خلال إعادة ترتيب الكروموسومات الجسمية وعدم استقرار الجينوم، وتموت جميع الخلايا تقريبا.

إطالة بديلة للتيلومير

ومع ذلك،فان  5-10٪ من السرطانات البشرية تقوم بعملية  إطالة بديلة التيلومير بمسار (ALT) ، الذي يعتمد على استطالة بوساطة إعادة التركيب. [21] ونادرا ما تخرج لخلايا من هذه الأزمة عن طريق إطالة التيلومير إما عن طريق التيلوميراز المنشط أظهر أو بروتين ALT , أول من اكتشف أن بروتين ال ALT يقوم بدور في إطالة التيلوميرات هم (مورنان وآخرون، 1994). وقد أكدت الدراسات اللاحقة دور ال ALT لإعادة التركيب في صيانة التيلومير التي كتبها (2000 دنهام وآخرون،)، إلا أن الآلية الدقيقة لهذا المسار لم يحدد بعد. خلايا ALT تنتج وفرة في دوائر T – ، التي ربما تلعب دورا في إعادة تركيب التيلومير الداخلية او ثبات دوائر ال T((Tomaska وآخرون، 2000؛. 2009؛ سيزار وغريفيث، 2004؛ وانغ وآخرون، 2004).

الجوانب التطورية

يعتقد البعض أن التيلوميرات الأقصر يمكن أن يكون سبب الشيخوخة، وهذا يطرح السؤال لماذا لم يتم تحديد التيلومير أطول للتخفيف هذه الآثار. ويشير هذا التفسير البارز إلى أن الشخص الذي يرث التيلوميرات الأطول يكون لديه نسبة اكبر من معدلات الإصابة بالسرطان (مثل اينشتاين وCiszek، 2002). ومع ذلك، فإن الدراسات اللاحقة تشير إلى أن  [20] هذا غير وارد، لان ارتباط زيادة معدلات الاصابة بالسرطان تكون اكبر مع التيلوميرات القصيرة ، ومعدل الوفيات الناجمة عن السرطان بسبب التيلوميرات يحدث في وقت متأخر من الحياة عندما تكون قوة الانتقاء الطبيعي منخفضة جدا. وقد تم تفسير الفرضية التي تحتوي أن التيلوميرات الأطول  لا تنتقى طبيعيا بسبب قابليتها للسرطان تسمى  فرضية المقتصد، التي تشير إلى أن آثار انتشار الخلوي للتيلومير الأطول زادت نفقات الطاقة. [20] وفي بيئات الحد حيوية، قد يكون التيلوميرات أقصر آلية تجنيب الطاقة.

العلاقة مع سرطان الثدي

في الثدي السليم للإناث ، هناك بعض الخلايا تسمى الأسلاف اللمعية التي تبطن قنوات الحليب التي يكون لديها خصائص  التكاثر والتمايز ومعظمها تحتوي التيلوميرات قصيرة حاسمة مع بؤر تالفة من الحمض النووي. ويعتقد أن من الممكن لهذه الخلايا  ان يكون لديها مواضع خلوية مشتركة التي قد تنشأ منها سرطانات الثدي التي تنطوي على تقلبات  التيلومير. [22] وتقصير التيلومير في هذه الخلايا لا علاقة لها بالعمر لكن هناك تكهنات أن تكون تعتمد على التمايز الظاهري  للخلايا القاعدية لاللمعية. أيضا، إن نشاط التيلوميراز مرتفع بشكل غير عادي في هذه الخلايا في النساء الأصغر سنا لكنه يتراجع مع تقدم السن. [23]

التقصير

يقصر التيلومير  بسبب مشكلة النسخ المتماثل لنهاية  الحمض النووي التي تحدث خلال تكرار الحمض النووي في حقيقيات النوى فقط. ويرجع السبب في ذلك أن تكرار الحمض النووي لا يبدأ  على طرفي سلسلتا الحمض النووي، ولكن يبدأ في الوسط، وبالنظر إلى أن عملية بلمرة الحمض النووي تتحرك في اتجاه 5 ‘إلى 3’ ، فسوف نجد السلسلة المتقدمة او المتأخرة  على جزيء الحمض النووي تصبح منسوخة.

السلاسل المتأخرة خلال بلمرة الحمض النووي

على سلسلتا الحمض النووي المتقدمة، يمكن لعملية  بلمرة DNA ان تكون  للحمض النووي السلسلتان التكميليتان دون أي صعوبة لأن البلمرة تكون باتجاه من 5 ‘إلى 3’. ومع ذلك، هناك مشكلة تسير في الاتجاه الآخر على السلسلة المتأخرة. لمواجهة هذا، تقوم سلسلة قصيرة من الحمض النووي الريبي بوصفها قاعدة نعلق على السلاسل المتأخرة على بعد مسافة قصيرة قبل حيث كان بدء الموقع.  يستطيع حينها بوليميريز الحمض النووي أن يبدأ التكرار في تلك المرحلة والذهاب الى نهاية هذا الموقع. هذا يتسبب في تشكيل شظايا أوكازاكي. والمزيد من ال  RNA التي  نعلق على سلسلتا الحمض النووي ويأتي الحمض النووي بوليميريز  على طول يواصل  بناء سلسلتا الحمض النووي الجديد.

في نهاية المطاف , يرتبط آخر حمض نووي رايبوزي , يأتي بوليميريز الحمض النووي و محلل الحمض النووي الرايبوزي و إنزيم ربط الحمض النووي (لاجيز) لتحوبل جزيئات ال حمض النووي الرايبوزي الموجودة في جزيئات اوكازاكي إلى حمض نووي (DNA) ولكن لتحويل جزيء DNA إلى RNA يجب أن يكون هناك سلسلة  DNA أمام مركب ال RNA

هذه العملية تحدث في كل أنحاء الحمض النووي الجديد عدا عند اتصال أخر جزيء  RNA, هناك يحطم أخر جزي باقي من ال RNA  على ال DNA  لذا , فهناك جزء من التيلومير يفقد عند كل عملية نسخ

ومع ذلك، فقد أظهرت الدراسات المخبرية أن التيلوميرات أكثر عرضة للإجهاد التأكسدي. هناك أدلة على أن تأكسد الحمض النووي بالتلف بوساطة الضغط هو من العوامل الهامة للتقصير التيلومير. [24]  تقصير التيلومير بسبب الجذور الحرة يوضح الفرق بين فقدانه المقدر بسبب مشكلة في نهاية التكرار (ج. 20 بي بي) و معدلات تقصير التيلومير الفعلية (50-100 بي بي)، ولها تأثير المطلق أكبر على طول التيلومير من التقصير الناجم عن مشكلة نهاية النسخ المتماثل. وقد أشارت الدراسات السكانية أيضا التفاعل بين تناول مضادة للأكسدة وطول التيلومير. في مشروع دراسة سرطان الثدي لونغ آيلاند (LIBCSP)، وجد أن هناك زيادة في خطر الاصابة بسرطان الثدي بين النساء مع التيلومير  الأقصر وذلك بقلة محتوى النظام الغذائي من البيتا كاروتين، وفيتامين C أو E. تشير [25] هذه النتائج أن خطر الإصابة بالسرطان بسبب  تقصير التيلومير قد يتفاعل مع غيرها من الآليات من الحمض النووي من التلف، والإجهاد التأكسدي على وجه التحديد.

ويرتبط عملية تقصير التيلومير مع تقدم العمر ، والوفيات والأمراض المرتبطة بتقدم السن. في عام 2003، اكتشف ريتشارد كاوتن أن أولئك الذين لديهم جزيئات أطول يعيشوا حياة أطول من اولئك الذين يحملون مع جزيئات قصيرة. [26] ومع ذلك، فإنه ليس من المعروف ما إذا كانت التيلوميرات قصيرة هي مجرد علامة من العمر الخلوي أو تساهم فعليا في عملية الشيخوخة. [بحاجة لمصدر ]

الإطالة

وقد لوحظت ظاهرة الانقسام الخلوي المحدودة لأول مرة من قبل ليونارد  هايفليك، وتسمى الان ( حد هايفليك ) [27 ] [28]  ووجدت بعدها اكتشافات هامة من قبل مجموعة من العلماء نظمت في شركة جيرون من قبل المؤسس غيرون مايكل D. الغربية أن تقصير التيلومير مرتبط مع الحد من الانقسام الخلوي ( حد هايفليك ). [29] وان تحفيز التيلوميريز في عملية الانقسام الخلوي يمكن له ان يؤدي إلى التقليل من تقصير التيلوميرات وبالتالي زيادة عمر الخلية ومنعها من الشيخوخة , وقد ظهر التيلوميراز في منشور عام 1998 في العلوم لتكون قادرة على تمديد عمر الخلية، والآن من المعترف به بأنه قادر على زيادة عمر الخلايا الجسدية البشرية .

أصبح من الواضح أن عكس عملية  تقصير التيلومير من خلال تفعيل مؤقت من التيلوميراز قد يكون وسيلة فعالة لإبطاء الشيخوخة. و هذا من شأنه سبب في إطالة عمر الإنسان لأنه سيكون تمديد المهلة حد الهايفليك. وقد اقترحت ثلاث طرق لعكس تقصير التيلومير: الأدوية، والعلاج الجيني، أو تقليل  الأيض، ما يسمى، سبات / السبات. وحتى الآن لم تثبت هذه الأفكار في البشر، ولكن ثبت أنه يتم عكس تقصير التيلومير في السبات ويتم إبطاء الشيخوخة (Turbill، وآخرون. 2012 و 2013) وذلك السبات يطيل فترة الحياة (ليمان وآخرون. 1981 ). وقد ثبت أيضا أن تمديد التيلومير قد عكس بنجاح بعض علامات الشيخوخة في فئران المختبر  [31] [32] وأنواع معينة من  دودة النيماتودا ايليجانس, [33] وقد تم الافتراض أن التيلوميرات الأطول بخاصة تلك التي تفعل  التيلوميراز قد تسبب ازدياد السرطان (على سبيل المثال وينشتاين وCiszek، 2002). ومع ذلك، التيلوميرات الأطول قد تحمي أيضا ضد السرطان، لأن التيلوميرات القصيرة  هي التي ترتبط مع مرض السرطان. وقيل أيضا أن التيلوميرات الأطول قد يسبب زيادة استهلاك الطاقة. [20]

تقنيات لتمديد التيلومير يمكن أن تكون مفيدة لهندسة الأنسجة، لأنها قد تسمح صحية خلايا الثدييات غير سرطاني، ليتم تربيتها في كميات كبيرة بما يكفي لتكون المواد الهندسية لإصلاح الطبية الحيوية.

 

وتظهر دراستان حديثتان على الطيور البحرية عاشت لفترة طويلة أن دور التيلومير هو أبعد من أن يكون مفهوما. في عام 2003، لاحظ العلماء أن التيلوميرات من ليتش عاصفة النوء (Oceanodroma leucorhoa) يبدو فيها أن هناك عملية اطالة للتيلومير  مع العمر الزمني، في أول مثال لوحظ مثل هذا السلوك للتيلومير. [34] وفي عام 2006، [35] ذكرت  Juola وآخرون.أنه في ان ذلك لا علاقة له , اذ ان هناك أنواع أخرى تعيش منذ فترة طويلة الطيور البحرية، وفرقاطة صغرى (Fregata قاصر)، طول التيلومير فيها لا يبدأ بالانخفاض حتى  c.40 (أي ربما طوال العمر كله)، ولكن سرعة الانخفاض تتباطئ بشكل كبير مع زيادة الأعمار وأن معدلات الانخفاض في  طول التيلومير تباينت بشدة بين الطيور الفردية. وخلصوا إلى أن في هذه الأنواع (وربما في الفرقاطات و شبيهاتها بشكل عام)، لا يمكن استخدام طول التيلومير لتحديد عمر الطير جيدا بما فيه الكفاية. وهكذا، يبدو أن هناك ما هو أكثر من ذلك بكثير من الاختلاف في سلوك طول التيلومير مما كان يعتقد في البداية.

وعلاوة على ذلك، وجد غوميز وآخرون. في دراسة علم الأحياء بمقارنة التيلومير في الثدييات، أن طول التيلومير من أنواع الثدييات المختلفة يرتبط عكسيا، وليس مباشرة، مع عمرها، وخلصوا إلى أن مساهمة طول التيلومير إلى عمر الكائن الحي لا تزال موضع جدل. [36] وجدت هاريس وآخرون . أدلة تذكر أن طول التيلومير هو العلامات البيولوجية الكبيرة من الشيخوخة الطبيعية  في البشر فيما يتعلق  بقدراتهم المعرفية والمادية الهامة. [37]  واختبر جيلي وبلاكبيرن ما إذا كانت الشيخوخة الخلوية في متناعلة ( البراميسيوم وهو  جِنْسُ مُهَدَّباتٍ مِنَ الكائنات الاولية) سببه تقصير التيلومير، ووجدت أن التيلوميرات لم تكن تقصر  أثناء الشيخوخة. [38]

التمرين الناجم عن الاطالة

جرت دراسة في 2013 من تجربة من usef   على 35 رجلا مصابين  بمرحلة مبكرة لسرطان البروستات قد بدأ 10 منهم في “تغيير نمط الحياة التي شملت: اتباع نظام غذائي المعتمد على النباتات (عالية في الفواكه والخضروات والحبوب غير المكررة، وانخفاض في الدهون والكربوهيدرات المكررة )؛ التمارين المعتدلة (المشي 30 دقيقة يوميا لمدة ستة أيام في الأسبوع)؛ الحد من التوتر (عمل اليوغا والتمتد، والتنفس، والتأمل) “وأيضا” مجموعة من الدعم الأسبوعي “. بالمقارنة مع ال 25 الاخرون من المشاركين في الدراسة ، “شهدت المجموعة التي جعلت من تغيير نمط الحياة زيادة” كبيرة “في طول التيلومير ما يقرب من 10 في المئة. وعلاوة على ذلك، تغيرت  سلوكياتهت من خلال الالتزام ببرنامج حياة الموصى بها، [39] وفي  دراسة عام  2014 بعنوان” النهوض من أجل صحتك” من خلال تجنب نمط الحياة غير الصحية   يمكن ان يؤدي إلى ان يطول التيلومير الخاصة بك , لكن هناك نتائج الثانوية من خلال تجارب سريرية عشوائية  على النشاط البدني لدى كبار السن ” التي أشارت  إلى نتائج متناقضة إلى حد ما، ففي. مجموعة التدخل، كان هناك ارتباط سلبي بين التغيرات في الوقت الذي يقضيه ممارسة والتغيرات في طول التيلومير (رو = -0.39، ع = 0.07). من ناحية أخرى، في مجموعة التدخل، كان مرتبطا بشكل كبير إطالة التيلومير مع خفض الوقت جالسا ( رو = -0.68، ع = 0.02). [40]

 

المتواليات

سيتم سرد تسلسل القواعد المعروفة من التيلومير إلى هذا الوقت  في قاعدة بيانات بموقع التيلوميراز.

المجموعة الكائن الحي تكرار التيلوميرات , من اتجاه 5 إلى 3
الفقاريات

 

الانسان , الفئران , القيطم TTAGGG
الفطريات الخيطية العُصَيْباءُ المُبَوِّغَة (جِنْسٌ مِنَ الفُطْرِيَّات الزَّقِّيَّة) TTAGGG
عَفَنٌ غَرَوِيّ فَوْقَعَة TTAGGG
Dictyostelium AG(1-8)
الحَيَوَاناتُ الأَوالِيّ المِثْقَبِيَّة (جنس من الأوالي) , الشُّعْرورِيَّة (جِنْسُ طُفَيلِيَّاتٍ مِنَ السَّوطِيَّات) TTAGGG
الاوليات الهدبية رباعية الغشاء TTGGGG
البراميسيوم TTGGG(T/G)
Oxytricha, Stylonychia, Euplotes TTTTGGGG
الاوليات ( المجمعات القمية ) البلازموديوم TTAGGG(T/C)
النباتات العليا نبات الأرابيدوبسيس TTTAGGG
نبات ملكة الليل TTTTTTAGGG[41]
الثوميات CTCGGTTATGGG[42]
الطحالب الخضراء الكلاميدونس TTTTAGGG
الحشرات دودة القز TTAGG
الديدان الحلقية الاسكارس TTAGGC
الخميرة المنشطرة الخميرة المنشطرة TTAC(A)(C)G(1-8)
الخميرة المتبرعمة Saccharomyces cerevisiae TGTGGGTGTGGTG (from RNA template)

or G(2-3)(TG)(1-6)T (consensus)

Saccharomyces castellii TCTGGGTG
Candida glabrata GGGGTCTGGGTGCTG
Candida albicans GGTGTACGGATGTCTAACTTCTT
Candida tropicalis GGTGTA[C/A]GGATGTCACGATCATT
Candida maltosa GGTGTACGGATGCAGACTCGCTT
Candida guillermondii GGTGTAC
Candida pseudotropicalis GGTGTACGGATTTGATTAGTTATGT
Kluyveromyces lactis GGTGTACGGATTTGATTAGGTATGT

 

 

السرطان

هذا الجزء يتطلب التوسع. (يونيو 2008)

يعتبر التيلومير عامل مهم للحفاظ على سلامة الجينوم , وتشير الدراسات إلى أن ضعف التيلومير أو تقصيره يكون  عادة خلال عملية نشوء الورم [43] التيلوميرات القصيرة يمكن أن تؤدي إلى عدم الاستقرار الجيني، وفقدان كروموسوم وتشكيل نقل للمواقع غير المتبادلة؛ والتيلوميرات في الخلايا السرطانية ومنتجاتها تكون أقصر بكثير من الأنسجة العادية المحيطة. [44] [45]

 

وقد وجدت الدراسات ايضا ان التيلوميرات القصيرة تكون في العديد من أنواع السرطانات: بما في ذلك البنكرياس والعظام والبروستاتا والمثانة والرئة والكلى والرأس والعنق. وبالإضافة إلى ذلك، تم العثور على الأشخاص الذين يعانون من أنواع عديدة من السرطان في الكريات البيض يمتلكون  تيلومير أقصر من الاصحاء. [46]  والدراسات الأخيرة تشير إلى ان هناك 1،4-3،0 ضعف لزيادة خطر الاصابة بسرطان لمن لديهم تيلوميرات أقصر  مقارنة بمن يحملون تيلوميرات أطول. [47] [48] ومع ذلك الزيادة في الخطر تختلف حسب العمر والجنس ونوع الورم والاختلافات في عوامل نمط الحياة.

وقد ترافقت أيضا بعض عوامل نمط الحياة ذاتها في الزيادة من خطر الإصابة بسرطان مع التيلوميرات القصيرة : بما في ذلك التوتر والتدخين وقلة النشاط البدني واتباع نظام غذائي عالي في السكريات المكررة [48] النظام الغذائي والنشاط البدني لديه تأثير في الالتهابات والاكسدة. ويعتقد أن هذه العوامل لديها تأثير على صيانة التيلومير. [49] كما تم ربط الاجهاد نفسي لشيخوخة الخلايا المعجل، كما يتضح من انخفاض نشاط التيلوميراز والتيلوميرات القصيرة. [50] وقد اقترح أن العمل على تعديل نمط الحياة، بما في ذلك اتباع نظام غذائي صحي وممارسة الرياضة والحد من التوتر، لديها القدرة على زيادة طول التيلومير،  وبالتالي عكس الشيخوخة الخلوية، والحد من مخاطر الأمراض المرتبطة بالشيخوخة.بما في ذلك التجارب الأخيرة لمرحلة مبكرة مرضى سرطان البروستات، وأسفرت تغييرات نمط الحياة شاملة في زيادة لفترة قصيرة في النشاط التيلوميراز والتعديل على المدى الطويل في طول التيلومير. [51] [52] تعديلات نمط الحياة لديها القدرة على تنظيم صيانة التيلومير وبدون تعزيز تكون الأورام، والآليات التقليدية لإطالة التيلومير تنطوي على استخدام  تفعيل التيلوميراز [بحاجة لمصدر].

تتطلب الخلايا السرطانية آلية للحفاظ على الحمض النووي في التيلوميرات الخاصة بهم من أجل مواصلة الانقسام إلى فترة أطول (زيادة عمرها). آلية استطالة التيلومير أو صيانته هي واحدة من الخطوات الرئيسية في زيادة عمر الخلية، ويمكن استخدامها كعلامة للتشخيص في العيادة. يتم تنشيط التيلوميراز،  وهو إنزيم معقد مسؤول عن تطويل التيلوميرات من خلال إضافة مكرر التيلومير إلى نهايات الكروموسومات، في ما يقرب من 80٪ من الأورام. [53] ومع ذلك، فإن جزء كبير من الخلايا السرطانية تستعمل إطالة بديلة التيلومير (ALT)، [54] وهو مسار التيلومير غير متحفظ بإطالة تنطوي على نقلو تكرار التيلومير جنبا إلى جنب بين شقيقة الصبغي. [55]

 

التيلوميراز هو الانزيم الطبيعي الذي يشجع إصلاح التيلومير. يكون نشطا في الخلايا الجذعية، الخلايا الجرثومية، بصيلات الشعر، و 90 في المئة من الخلايا السرطانية، ولكن وجوده منخفض أو غير موجود في الخلايا الجسدية. وظائف تيلوميراز بإضافة قواعد لنهايات التيلوميرات. وتعتبر الخلايا مع النشاط التيلوميراز كافية لزيادة عمرها في بمعنى أنها يمكن أن نقسم بزيادة عن حد هايفليك دون الدخول الشيخوخة أو موت الخلايا المبرمج. لهذا السبب، ينظر للتيلوميراز كهدف محتمل للأدوية المضادة للسرطان (مثل Imetelstat غيرون في الوقت الراهن في التجارب السريرية على البشر وtelomestatin). [56]

 

وقد أثبتت الدراسات باستخدام الفئران بأن دور التيلومير في السرطان على حد سواء يمكن أن يحد من نمو الورم، وكذلك تعزيز تكون الأورام، وهذا يتوقف على نوع من الخلايا والسياق الجيني. [57] [58]

وتعمل العديد من التقنيات حاليا لتقييم متوسط طول التيلومير في الخلايا حقيقية النواة. احدى الاساليب هي تقييد جزء المحطة الطرفية (TRF) الطخة الجنوبية، [59] الذي ينطوي على تهجين 32P- المشعة (TTAGGG)  في مسبار النوكليوتيد إلى Hinf / آر إس إيه التي تحطم الحمض النووي الجيني تضمينيا على غشاء النايلون وبعد ذلك يتعرض لautoradiographic  فيلم أو شاشة مُصَوِّر الفوسفور.  هناك طريقة آخرى، تسمى Q-FISH، وهي تهجين في موقع مُفَلْوَر (FISH). [60] Q-FISH، لكنه يتطلب كميات كبيرة من الحمض النووي الجيني (2-20 ميكروغرام) الذي يجعل استخدامها محدودا في دراسات وبائية كبيرة . وقد تم التغلب على بعض هذه العوائق مع الوقت الحالي بفحص تفاعل البوليميراز المتسلسل اللحظي لطول التيلومير وتدفق التهجين.الذي ينطوي على  تحديد نسبة التيلومير إلى نسخة  وحدة من الجين (T / S)، [61] والذي أظهر أن تكون متناسبة مع متوسط طول التيلومير في الخلية.

هناك تقنية أخرى تسمى تحليل اطالة التيلومير الاحادي (STELA) التي وضعت في عام 2003 من قبل دنكان بيرد.

هذه التقنية تساعد على الأبحاث التي تستهدف نهايات التيلومير و هو أمر غير ممكن مع تحليل TRF .

ولكن نظرا لان هذه  التقنية تستند الى PCR, فان التيلومير أكبر من 25KB لا يمكن اطالته، وهناك انحياز نحو التيلوميرات الاقصر.

في حين أن هناك شركات متعددة تقدم خدمات قياس طول التيلومير، [62] [63] [64] هناك تشكيك في جدوى هذه القياسات للاستخدام السريري أو الشخصي على نطاق واسع من قبل العلماء البارزين دون المصالح المالية في هذه الشركات. [65] [66]  مثل إليزابيث بلاكبيرن الفائز بجائزة نوبل ، الذي كان مؤسسا مشاركا لواحدة من هذه الشركات وعززت بعمل على إيجاد فائدة سريرية من دراسات طول التيلومير، [67] استقال من الشركة في يونيو 2013 “نظرا لتغير وشيك في السيطرة على  التيلوميرفي الصحة” . [68]

في الثقافة الشعبية

يسمى بداية مقطع من الألبوم  الذي أنتج عام 2016، من قبل موسيقى الروك إيندي ، المملكة المتحدة ، الطائرات والغموض (منحنى الأرض)، التيلومير ويحتوي على المقطع التالي:

في شريط الحامض النووي الذي يعيش في داخلنا

والناس يسيرون الأسفل

يزحفون لبيوتهم لوحدهم  مثل العناكب

كما السرطان يبدأ في النمو ببطء

 

المراجع

 

Jump up ^ Sadava, D., Hillis, D., Heller, C., & Berenbaum, M. (2011). Life: The science of biology. (9th ed.) Sunderland, MA: Sinauer Associates Inc.

Jump up ^ AtGoogleTalks, August 20, 2008 Molecular biologist Elizabeth Blackburn

Jump up ^ Passarge, Eberhard. Color atlas of genetics, 2007.

Jump up ^ Olovnikov, Alexei M. (1971). Принцип маргинотомии в матричном синтезе полинуклеотидов [Principle of marginotomy in template synthesis of polynucleotides]. Doklady Akademii Nauk SSSR (in Russian) 201 (6): 1496–9. PMID 5158754.

Jump up ^ Olovnikov AM (September 1973). “A theory of marginotomy. The incomplete copying of template margin in enzymic synthesis of polynucleotides and biological significance of the phenomenon”. J. Theor. Biol. 41 (1): 181–90. doi:10.1016/0022-5193(73)90198-7. PMID 4754905.

Jump up ^ “No Nobel physiology and medicine award for Russian gerontologist Aleksey Olovnikov”. Telegraph. October 21, 2009.

Jump up ^ Blackburn AM; Gall, Joseph G. (March 1978). “A tandemly repeated sequence at the termini of the extrachromosomal ribosomal RNA genes in Tetrahymena”. J. Mol. Biol. 120 (1): 33–53. doi:10.1016/0022-2836(78)90294-2. PMID 642006.

Jump up ^ “The 2009 Nobel Prize in Physiology or Medicine – Press Release”. Nobelprize.org. 2009-10-05. Retrieved 2012-06-12.

Jump up ^ Harrison’s Principles of Internal Medicine, Ch. 69, Cancer cell biology and angiogenesis, Robert G. Fenton and Dan L. Longo, p. 454.

Jump up ^ “Portfolio”.

Jump up ^ “Unravelling the secret of ageing”. COSMOS: The Science of Everything. October 5, 2009. Archived from the original on January 14, 2015.

^ Jump up to: a b Blasco, Maria; Paula Martínez (21 Jun 2010). “Role of shelterin in cancer and aging”. Aging Cell 9 (5): 653–666. doi:10.1111/j.1474-9726.2010.00596.x. PMID 20569239.

Jump up ^ Lundblad, 2000; Ferreira et al., 2004

Jump up ^ Maloy, Stanley (July 12, 2002). “Bacterial Chromosome Structure”. Retrieved 2008-06-22.

Jump up ^ Robert P. Lanza, Jose B. Cibelli, Catherine Blackwell, Vincent J. Cristofalo, Mary Kay Francis, Gabriela M. Baerlocher, Jennifer Mak, Michael Schertzer, Elizabeth A. Chavez, Nancy Sawyer, Peter M. Lansdorp, Michael D. West1 (28 April 2000). “Extension of Cell Life-Span and Telomere Length in Animals Cloned from Senescent Somatic Cells” (PDF). Science.

Jump up ^ Shampay , Szostak J.W., Blackburn E.H.; Szostak; Blackburn (1984). “DNA sequences of telomeres maintained in yeast”. Nature 310 (5973): 154–157. doi:10.1038/310154a0. PMID 6330571.

Jump up ^ “Characterization of the yeast telomere nucleoprotein core: Rap1 binds independently to each recognition site”. J. Biol. Chem. 285: 35814–24. 2010. doi:10.1074/jbc.M110.170167. PMC 2975205. PMID 20826803.

Jump up ^ Griffith J, Comeau L, Rosenfield S, Stansel R, Bianchi A, Moss H, de Lange T; Comeau; Rosenfield; Stansel; Bianchi; Moss; De Lange (1999). “Mammalian telomeres end in a large duplex loop”. Cell 97 (4): 503–14. doi:10.1016/S0092-8674(00)80760-6. PMID 10338214.

Jump up ^ Burge S, Parkinson G, Hazel P, Todd A, Neidle S; Parkinson; Hazel; Todd; Neidle (2006). “Quadruplex DNA: sequence, topology and structure”. Nucleic Acids Res 34 (19): 5402–15. doi:10.1093/nar/gkl655. PMC 1636468. PMID 17012276.

^ Jump up to: a b c d e Eisenberg DTA (2011). “An evolutionary review of human telomere biology: The thrifty telomere hypothesis and notes on potential adaptive paternal effects”. American Journal of Human Biology 23 (2): 149–167. doi:10.1002/ajhb.21127. PMID 21319244.

Jump up ^ Henson, JD; Neumann, AA; Yeager, TR; Reddel, RR (2002). “Alternative lengthening of telomeres in mammalian cells”. Oncogene 21 (4): 598–610. doi:10.1038/sj.onc.1205058. PMID 11850785.

Jump up ^ BBC, World/Mundo. “Resuelven misterio sobre el origen del cáncer de mama”.

Jump up ^ Kannan, Nagarajan; Nazmul Huda, LiRen Tu, Radina Droumeva, Geraldine Aubert, Elizabeth Chavez, Ryan R. Brinkman, Peter Lansdorp, Joanne Emerman, Satoshi Abe, Connie Eaves, David Gilley (4 June 2013). “The Luminal Progenitor Compartment of the Normal Human Mammary Gland Constitutes a Unique Site of Telomere Dysfunction”. Stem Cell Reports 1 (1): 28–31. doi:10.1016/j.stemcr.2013.04.003. PMID 24052939.

Jump up ^ Richter, T; von Zglinicki, T (2007). “A continuous correlation between oxidative stress and telomere shortening in fibroblasts”. Exp Gerontol 42 (11): 1039–1042. doi:10.1016/j.exger.2007.08.005. PMID 17869047.

Jump up ^ Shen, J; Gammon, MD; Terry, MB; Wang, Q; Bradshaw, P; Teitelbaum, SL; Neugut, AI; Santella, RM (Apr 2009). “Telomere length, oxidative damage, antioxidants and breast cancer risk”. Int J Cancer 124 (7): 1637–43. doi:10.1002/ijc.24105.

Jump up ^ Cawthon, RM; Smith, KR; O’Brien, E; Sivatchenko, A; Kerber, RA (2003). “Association between telomere length in blood and mortality in people aged 60 years or older”. Lancet 361 (9355): 393–395. doi:10.1016/s0140-6736(03)12384-7.

Jump up ^ Hayflick L, Moorhead PS; Moorhead (1961). “The serial cultivation of human diploid cell strains”. Exp Cell Res 25 (3): 585–621. doi:10.1016/0014-4827(61)90192-6. PMID 13905658.

Jump up ^ Hayflick L. (1965). “The limited in vitro lifetime of human diploid cell strains”. Exp. Cell Res. 37 (3): 614–636. doi:10.1016/0014-4827(65)90211-9. PMID 14315085.

Jump up ^ Feng J, Funk WD, Wang SS, Weinrich SL, Avilion AA, Chiu CP, Adams RR, Chang E, Allsopp RC, Yu J; Funk; Wang; Weinrich; Avilion; Chiu; Adams; Chang; Allsopp; Yu (September 1995). “The RNA component of human telomerase”. Science 269 (5228): 1236–41. doi:10.1126/science.7544491. PMID 7544491.

Jump up ^ Bodnar, A.G.; Ouellette, M.; Frolkis, M.; Holt, S.E.; Chiu, C.P.; Morin, G.B.; Harley, C.B.; Shay, J.W.; Lichtsteiner, S.; Wright, W.E. (1998). “Extension of life-span by introduction of telomerase into normal human cells”. Science 279 (5349): 349–352. doi:10.1126/science.279.5349.349.

Jump up ^ Sample, Ian (November 28, 2010). “Harvard scientists reverse the ageing process in mice – now for humans”. The Guardian (London).

Jump up ^ http://www.nature.com/nature/journal/vaop/ncurrent/full/nature09603.html

Jump up ^ Joeng KS, Song EJ, Lee KJ, Lee J; Song; Lee; Lee (2004). “Long lifespan in worms with long telomeric DNA”. Nature Genetics 36 (6): 607–11. doi:10.1038/ng1356. PMID 15122256.

Jump up ^ Nakagawa S, Gemmell NJ, Burke T; Gemmell; Burke (September 2004). “Measuring vertebrate telomeres: applications and limitations”. Mol. Ecol. 13 (9): 2523–33. doi:10.1111/j.1365-294X.2004.02291.x. PMID 15315667.

Jump up ^ Juola, Frans A; Haussmann, Mark F; Dearborn, Donald C; Vleck, Carol M (2006). “Telomere shortening in a long-lived marine bird: Cross-sectional analysis and test of an aging tool”. The Auk 123 (3): 775. doi:10.1642/0004-8038(2006)123[775:TSIALM]2.0.CO;2. ISSN 0004-8038.

Jump up ^ Gomes, NM; Ryder, OA; Houck, ML; Charter, SJ; Walker, W; Forsyth, NR; Austad, SN; Venditti, C; Pagel, M; Shay, JW; Wright, WE (2011). “Comparative biology of mammalian telomeres: hypotheses on ancestral states and the roles of telomeres in longevity determination”. Aging Cell 10 (5): 761–768. doi:10.1111/j.1474-9726.2011.00718.x. PMC 3387546. PMID 21518243.

Jump up ^ Harris, SE; Martin-Ruiz, C; von Zglinicki, T; Starr, JM; Deary, IJ (2010). “Telomere length and aging biomarkers in 70-year-olds: the Lothian Birth Cohort 1936”. Neurobiol Aging 33 (7): 1486.e3–1486.e8. doi:10.1016/j.neurobiolaging.2010.11.013. PMID 21194798.

Jump up ^ Gilley, D; Blackburn, EH (1994). “Lack of telomere shortening during senescence in Paramecium”. Proc Natl Acad Sci U S A 91 (5): 1955–1958. doi:10.1073/pnas.91.5.1955. PMID 8127914.

Jump up ^ Fernandez, Elizabeth (2013-09-16). “Lifestyle Changes May Lengthen Telomeres, A Measure of Cell Aging”. http://www.ucsf.edu/. University of California, San Francisco. Retrieved 2015-03-16. External link in |website= (help)

Jump up ^ Sjögren, P; Fisher, R; Kallings, L; Svenson, U; Roos, G; Hellénius, M (2014-09-03). “Stand up for health–avoiding sedentary behaviour might lengthen your telomeres: secondary outcomes from a physical activity RCT in older people.”. Br J Sports Med 48: 1407–9. doi:10.1136/bjsports-2013-093342. PMID 25185586.

Jump up ^ Peška, Vratislav; Fajkus, Petr; Fojtová, Miloslava; Dvořáčková, Martina; Hapala, Jan; Dvořáček, Vojtěch; Polanská, Pavla; Leitch, Andrew R.; Sýkorová, Eva; Fajkus, Jiří (May 2015). “Characterisation of an unusual telomere motif (TTTTTTAGGG) in the plant (Solanaceae), a species with a large genome”. The Plant Journal 82 (4): 644–654. doi:10.1111/tpj.12839.

Jump up ^ Fajkus, Petr; Peška, Vratislav; Sitová, Zdeňka; Fulnečková, Jana; Dvořáčková, Martina; Gogela, Roman; Sýkorová, Eva; Hapala, Jan; Fajkus, Jiří (2016). “Allium telomeres unmasked: the unusual telomeric sequence (CTCGGTTATGGG)n is synthesized by telomerase”. The Plant Journal 85 (3): 337–347. doi:10.1111/tpj.13115.

Jump up ^ Raynaud, CM; Sabatier, L; Philipot, O; Olaussen, KA; Soria, JC (2008). “Telomere length, telomeric proteins and genomic instability during the multistep carcinogenic process”. Crit Rev Oncol Hematol 66: 99–117. doi:10.1016/j.critrevonc.2007.11.006.

Jump up ^ Blasco, MA; Lee, HW; Hande, MP; Samper, E; Lansdorp, PM; et al. (1997). “Telomere shortening and tumor formation by mouse cells lacking telomerase RNA”. Cell 91 (1): 25–34. doi:10.1016/s0092-8674(01)80006-4.

Jump up ^ Artandi, SE; Chang, S; Lee, SL; Alson, S; Gottlieb, GJ; et al. (2000). “Telomere dysfunction promotes non-reciprocal translocations and epithelial cancers in mice”. Nature 406: 641–645. doi:10.1038/35020592.

Jump up ^ Willeit Peter, Willeit Johann, Mayr Anita, Weger Siegfried, Oberhollenzer Friedrich, Brandstätter Anita, Kronenberg Florian, Kiechl Stefan; Willeit; Mayr; Weger; Oberhollenzer; Brandstätter; Kronenberg; Kiechl (2010). “Telomere length and risk of incident cancer and cancer mortality”. JAMA 304 (1): 69–75. doi:10.1001/jama.2010.897. PMID 20606151.

Jump up ^ Ma, H; Zhou, Z; Wei, S; et al. (2011). “Shortened telomere length is associated with increased risk of cancer: a meta-analysis”. PLOS ONE 6 (6): e20466. doi:10.1371/journal.pone.0020466.

^ Jump up to: a b Wentzensen, IM; Mirabello, L; Pfeiffer, RM; Savage, SA (2011). “The association of telomere length and cancer: a meta-analysis”. Cancer Epidemiol Biomarkers Prev. 20 (6): 1238–1250. doi:10.1158/1055-9965.epi-11-0005.

Jump up ^ Paul, L (Oct 2011). “Diet, nutrition and telomere length”. J Nurt Biochem 22 (10): 895–901. doi:10.1016/j.jnutbio.2010.12.001.

Jump up ^ Epel, ES; Lin, J; Wilhelm, FH; Wolkowitz, OM; Cawthon, R; Adler, NE; Dolbier, C; Mendes, WB; Blackburn, EH (April 2006). “Cell aging in relation to stress arousal and cardiovascular disease risk factors”. Psychoneuroendocrinology 31 (3): 277–87. doi:10.1016/j.psyneuen.2005.08.011.

Jump up ^ Ornish, D; Lin, J; Chan, JM; Epel, E; Kemp, C; Weidner, G; Marlin, R; Frenda, SJ; Magbanua, MJ; Daubenmier, J; Estay, I; Hills, NK; Chainani-Wu, N; Carroll, PR; Blackburn, EH (Oct 2013). “Effect of comprehensive lifestyle changes on telomerase activity and telomerelength in men with biopsy-proven low-risk prostate cancer: 5-year follow-up of a descriptive pilot study”. Lancet Oncol 14 (11): 1112–20. doi:10.1016/S1470-2045(13)70366-8.

Jump up ^ Ornish, D; Lin, J; Daubenmier, J; Weidner, G; Epel, E; Kemp, C; Magbanua, MJ; Marlin, R; Yglecias, L; Carroll, PR; Blackburn, EH (Nov 2008). “Increased telomerase activity and comprehensive lifestyle changes: a pilot study”. Lancet Oncol 9 (11): 1048–57. doi:10.1016/S1470-2045(08)70234-1.

Jump up ^ Aschacher; Wolf; Enzmann; Kienzl (2015). “ALINE-1 induces hTERT and ensures telomere maintenance in tumour cell lines”. Oncogene. doi:10.1038/onc.2015.65.

Jump up ^ Henson JD, Neumann AA, Yeager TR, Reddel RR; Neumann; Yeager; Reddel (2002). “Alternative lengthening of telomeres in mammalian cells”. Oncogene 21 (4): 598–610. doi:10.1038/sj.onc.1205058. PMID 11850785.

Jump up ^ Chris Molenaar; Karien Wiesmeijer; Nico P. Verwoerd; Shadi Khazen; Roland Eils; Hans J. Tanke & Roeland W. Dirks (2003-12-15). “Visualizing telomere dynamics in living mammalian cells using PNA probes”. The EMBO Journal (The European Molecular Biology Organization) 22 (24): 6631–6641. doi:10.1093/emboj/cdg633. PMC 291828. PMID 14657034.

Jump up ^ Philippi C, Loretz B, Schaefer UF, Lehr CM.; Loretz; Schaefer; Lehr (April 2010). “Telomerase as an emerging target to fight cancer – Opportunities and challenges for nanomedicine”. Journal of Controlled Release 146 (2): 228–40. doi:10.1016/j.jconrel.2010.03.025. PMID 20381558.

Jump up ^ Chin L, Artandi SE, Shen Q, et al. (May 1999). “p53 deficiency rescues the adverse effects of telomere loss and cooperates with telomere dysfunction to accelerate carcinogenesis”. Cell 97 (4): 527–38. doi:10.1016/S0092-8674(00)80762-X. PMID 10338216.

Jump up ^ Greenberg RA, Chin L, Femino A, et al. (May 1999). “Short dysfunctional telomeres impair tumorigenesis in the INK4a(delta2/3) cancer-prone mouse”. Cell 97 (4): 515–25. doi:10.1016/S0092-8674(00)80761-8. PMID 10338215.

Jump up ^ Allshire RC; et al. (1989). “Human telomeres contain at least three types of G-rich repeat distributed non-randomly”. Nucleic Acids Res. 17 (12): 4611–4627. doi:10.1093/nar/17.12.4611. PMC 318019. PMID 2664709.

Jump up ^ Rufer N; et al. (1998). “Telomere length dynamics in human lymphocyte subpopulations measured by flow cytometry”. Nat Biotechnol 16 (8): 743–747. doi:10.1038/nbt0898-743. PMID 9702772.

Jump up ^ Cawthon, RM (2002). “Telomere measurement by quantitative PCR”. Nucleic Acids Research 30 (10): e47. doi:10.1093/nar/30.10.e47. PMC 115301. PMID 12000852.

Jump up ^ “Titanovo, Inc”. Titanovo.com. Retrieved 2015-04-15.

Jump up ^ “Telome Health, Inc”. Telomehealth.com. Retrieved 2013-07-13.

Jump up ^ “TeloMe Home”. Telome.com. Retrieved 2013-07-13.

Jump up ^ “A Blood Test Offers Clues to Longevity”.

Jump up ^ Zglinicki, T. v. (13 March 2012). “Will your telomeres tell your future?” (PDF). BMJ 344 (mar13 1): e1727–e1727. doi:10.1136/bmj.e1727.

Jump up ^ Jo Marchant. “Spit test offers guide to health : Nature News”. Nature.com. Retrieved 2013-07-13.

Jump up ^ “Elizabeth Blackburn calls time on ‘fountain of youth’ firm Telome Health”.

Jump up ^ “Telomere Lyrics”.

اسم المترجم: رنا احمد هروط

تعليق ١

آخر المقالات